Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04836

HP ID(1) HP04836
Gene ID(2) 26136
Gene Symbol finder TES
Protein Name testis derived transcript (3 LIM domains)
RefSeq NM_015641.2
Length of RefSeq (bp) 2766
Chromosome 7q31.2
Reference DDBJ accession
UniGene Hs.592286

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14B12 pKA1U5 GGCGGCGGACTGGGCGGCGGAAGTTCGACGGCGCCGGGCGAGTGGCTGTTGAGCGGCGCC
ARe99C06 pKA1U5 ATCCTGGGCCGCAGGCCCGCTGCGGCGGACTGGGCGGCGGAAGTTCGACGGCGCCGGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl