Prev. | 

RIKEN DNA Bank Human Resource - TES

Gene ID NCBI Gene 26136 |  KEGG hsa:26136
Gene Symbol TES
Protein Name testin LIM domain protein
Synonyms TESS|TESS-2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028596 IRAK071I04 pBluescriptR BC040208 NM_152829 Partial/var
HGY042550 IRAK106G06 pBluescript BC045580 NM_152829 Partial/var
HGY081739 IRAL004F19 pOTB7 BC001451 NM_152829 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045636 ARe14B12 pKA1U5 NM_015641.2  
GGCGGCGGACTGGGCGGCGGAAGTTCGACGGCGCCGGGCGAGTGGCTGTTGAGCGGCGCC
HKR079654 ARe99C06 pKA1U5 NM_015641.2  
ATCCTGGGCCGCAGGCCCGCTGCGGCGGACTGGGCGGCGGAAGTTCGACGGCGCCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl