Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04824

HP ID(1) HP04824
Gene ID(2) 10714
Gene Symbol finder POLD3
Protein Name polymerase (DNA-directed), delta 3, accessory subunit
RefSeq NM_006591.1
Length of RefSeq (bp) 3430
Chromosome 11q14
Reference DDBJ accession
UniGene Hs.82502

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13C11 pKA1U5 GGTCCCAGCGCTGCCGCACCATGGCGGACCAGCTTTATCTGGAAAATATAGACGAGTTCG
ARe46E05 pKA1U5 GCGGCGGGAGCTGTGGCTGTGATTGAGAGAGGGGTTAGAGGCGGGTCCCAGCGCTGCCGC
RBb64D11 pGCAP1 AAATGTGGAGAGGCGGGTCCCAGCGCTGCCGCACCATGGCGGACCAGCTTTATCTGGAAA
RBdS156B04 pGCAP10 GCTGGGAGGGAGCAAAGACGTTTCCCGCCGGCGGGAGCTGTGGCTGTGATTGAGAGAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl