Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - POLD3

Gene ID (NCBI) 10714
Gene Symbol POLD3
Protein Name polymerase (DNA-directed), delta 3, accessory subunit
Synonyms P66|P68
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03504)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010927 IRAK027F07 pCMV-SPORT6 BC020587 NM_006591 Partial/var
HGY099503 IRAL048M15 pDNR-LIB BC058840 NM_006591 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045259 ARe13C11 pKA1U5 NM_006591.1  
GGTCCCAGCGCTGCCGCACCATGGCGGACCAGCTTTATCTGGAAAATATAGACGAGTTCG
HKR058501 ARe46E05 pKA1U5 NM_006591.1  
GCGGCGGGAGCTGTGGCTGTGATTGAGAGAGGGGTTAGAGGCGGGTCCCAGCGCTGCCGC
HKR345683 RBb64D11 pGCAP1 NM_006591.1  
AAATGTGGAGAGGCGGGTCCCAGCGCTGCCGCACCATGGCGGACCAGCTTTATCTGGAAA
HKR462428 RBdS156B04 pGCAP10 NM_006591.1  
GCTGGGAGGGAGCAAAGACGTTTCCCGCCGGCGGGAGCTGTGGCTGTGATTGAGAGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl