Prev. |  KEGG KO K03504 > 

RIKEN DNA Bank Human Resource - POLD3

Gene ID NCBI Gene 10714 |  KEGG hsa:10714
Gene Symbol POLD3
Protein Name DNA polymerase delta 3, accessory subunit
Synonyms P66|P68|PPP1R128
Ortholog resources KEGG ortholog (KEGG orthology K03504) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010927 IRAK027F07 pCMV-SPORT6 BC020587 NM_006591 Partial/var
HGY099503 IRAL048M15 pDNR-LIB BC058840 NM_006591 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045259 ARe13C11 pKA1U5 NM_006591.1  
GGTCCCAGCGCTGCCGCACCATGGCGGACCAGCTTTATCTGGAAAATATAGACGAGTTCG
HKR058501 ARe46E05 pKA1U5 NM_006591.1  
GCGGCGGGAGCTGTGGCTGTGATTGAGAGAGGGGTTAGAGGCGGGTCCCAGCGCTGCCGC
HKR345683 RBb64D11 pGCAP1 NM_006591.1  
AAATGTGGAGAGGCGGGTCCCAGCGCTGCCGCACCATGGCGGACCAGCTTTATCTGGAAA
HKR462428 RBdS156B04 pGCAP10 NM_006591.1  
GCTGGGAGGGAGCAAAGACGTTTCCCGCCGGCGGGAGCTGTGGCTGTGATTGAGAGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl