Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04823

HP ID(1) HP04823
Gene ID(2) 55687
Gene Symbol finder TRMU
Protein Name tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
RefSeq NM_018006.4
Length of RefSeq (bp) 1974
Chromosome 22q13
Reference DDBJ accession
UniGene Hs.439524

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13C06 pKA1U5 GGGTAGCTGCAGCTGGCGAAGTTGGGCGACTGGCGGATGCAGGCCTTGCGGCACGTCGTG
ARi08G05 pGCAP10 CGGCCGGCCGATGAGCTGCAGCTGGCGAAGTTGGGCGACTGGCGGATGCAGGCCTTGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl