Prev. |  KEGG KO K21027 > 

RIKEN DNA Bank Human Resource - TRMU

Gene ID NCBI Gene 55687 |  KEGG hsa:55687
Gene Symbol TRMU
Protein Name tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Synonyms LCAL3|MTO2|MTU1|TRMT|TRMT1
Ortholog resource in our bank

  TRMU

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY103894 IRAL059M06 pOTB7 BC080631 NM_001008571 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045254 ARe13C06 pKA1U5 NM_018006.4  
GGGTAGCTGCAGCTGGCGAAGTTGGGCGACTGGCGGATGCAGGCCTTGCGGCACGTCGTG
HKR163349 ARi08G05 pGCAP10 NM_018006.4  
CGGCCGGCCGATGAGCTGCAGCTGGCGAAGTTGGGCGACTGGCGGATGCAGGCCTTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl