Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04822

HP ID(1) HP04822
Gene ID(2) 144501
Gene Symbol finder KRT80
Protein Name keratin 80
RefSeq NM_182507.2
Length of RefSeq (bp) 3859
Chromosome 12q13.13
Reference DDBJ accession
UniGene Hs.140978

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13C03 pKA1U5 TTGCCTTTTGCCAACTCCCCACCCCCAACCCACCCGGCCAGATCCAGCCTTGGCCCCCTC
ARe30D05 pKA1U5 GGGGGGCACCATGGCCTGCCGCTCCTGCGTGGTTGGCTTCAGCAGCCTCAGCAGCTGTGA
ARe97E11 pKA1U5 GGCTTCCGGCCGGGGGCACCATGGCCTGCCGCTCCTGCGTGGTTGGCTTCAGCAGCCTCA
ARi14C06 pGCAP10 TGAGTCCCCAGCCCGCCCCAGCTGTGACCAGAGCAACCAGAGCCTGCCACCCGACGCAAC
ARi26D10 pGCAP10 GAGTCCCCAGCCCGCCCCAGCTGTGACCAGAGCAACCAGAGCCTGCCACCCGACGCAACC
ARiS191K12 pGCAP10 GAGCTGTGACCAGAGCAACCAGAGCCTGCCACCCGACGCAACCCCAGGCTCACTCGCTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl