Prev. |  KEGG KO K07605 > 

RIKEN DNA Bank Human Resource - KRT80

Gene ID NCBI Gene 144501 |  KEGG hsa:144501
Gene Symbol KRT80
Protein Name keratin 80
Synonyms KB20
Ortholog resources KEGG ortholog (KEGG orthology K07605) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY100339 IRAL050O03 pOTB7 BC065180 NM_182507 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045251 ARe13C03 pKA1U5 NM_182507.2  
TTGCCTTTTGCCAACTCCCCACCCCCAACCCACCCGGCCAGATCCAGCCTTGGCCCCCTC
HKR052077 ARe30D05 pKA1U5 NM_182507.2  
GGGGGGCACCATGGCCTGCCGCTCCTGCGTGGTTGGCTTCAGCAGCCTCAGCAGCTGTGA
HKR078907 ARe97E11 pKA1U5 NM_182507.2  
GGCTTCCGGCCGGGGGCACCATGGCCTGCCGCTCCTGCGTGGTTGGCTTCAGCAGCCTCA
HKR165654 ARi14C06 pGCAP10 NM_182507.2  
TGAGTCCCCAGCCCGCCCCAGCTGTGACCAGAGCAACCAGAGCCTGCCACCCGACGCAAC
HKR170482 ARi26D10 pGCAP10 NM_182507.2  
GAGTCCCCAGCCCGCCCCAGCTGTGACCAGAGCAACCAGAGCCTGCCACCCGACGCAACC
HKR276652 ARiS191K12 pGCAP10 NM_182507.2  
GAGCTGTGACCAGAGCAACCAGAGCCTGCCACCCGACGCAACCCCAGGCTCACTCGCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl