Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04818

HP ID(1) HP04818
Gene ID(2) 55357
Gene Symbol finder TBC1D2
Protein Name TBC1 domain family, member 2
RefSeq NM_018421.3
Length of RefSeq (bp) 3330
Chromosome 9q22.33
Reference DDBJ accession
UniGene Hs.371016

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13A08 pKA1U5 GGCCCCCGCCCAGGTGTCTCCCTTTGGGAAGCTGCCCGCCGAGTCTCCGAGATTTGTCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl