Prev. |  KEGG KO K20165 > 

RIKEN DNA Bank Human Resource - TBC1D2

Gene ID NCBI Gene 55357 |  KEGG hsa:55357
Gene Symbol TBC1D2
Protein Name TBC1 domain family member 2
Synonyms PARIS-1|PARIS1|TBC1D2A
Ortholog resource in our bank

  TBC1D2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14983 pEGFP-C1-human TBC1D2A Expression vector of human TBC1 domain family member 2 (TBC1D2), fused with N-terminal EGFP, CMV promoter.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011934 IRAK029N22 pCMV-SPORT6 BC028918 NM_018421 Partial/var
HGY103322 IRAL058F02 pOTB7 BC071978 NM_018421

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045208 ARe13A08 pKA1U5 NM_018421.3  
GGCCCCCGCCCAGGTGTCTCCCTTTGGGAAGCTGCCCGCCGAGTCTCCGAGATTTGTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl