Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04795

HP ID(1) HP04795
Gene ID(2) 26147
Gene Symbol finder PHF19
Protein Name PHD finger protein 19
RefSeq NM_015651.1
Length of RefSeq (bp) 4287
Chromosome 9q33.2
Reference DDBJ accession
UniGene Hs.460124

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11G04 pKA1U5 GACTCGGCCGGGCAGCCGCGGGCCGAGCGCAGCCGCCTCCGCCACCGATGCGCCTGGTGG
ARe35A12 pKA1U5 GCTTTTCGAAATCTCCCTGAACTTTGGCGGCCCGAACGCCTCTGGGGGTGTCAGGGGAAG
RBb01A09 pKA1U5
RBd27F06 pGCAP10 GGAAAAAGATGGCGCCCCGCGCCCGGGGGGCCCCTTCCTGAGCGCCCCGGCCCCTCCCTC
RBd73F12 pGCAP10 GACTCGGCCGGGCAGCCGCGGGCCGAGCGCAGCCGCCTCCGCCACCGATGCGCCTGGTGG
RBdS177L05 pGCAP10 GGGGCCGAGCGCAGCCGCCTCCGCCACCGATGCGCCTGGTGGCCAGACTCCAAGTGGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl