Prev. |  KEGG KO K11486 > 

RIKEN DNA Bank Human Resource - PHF19

Gene ID NCBI Gene 26147 |  KEGG hsa:26147
Gene Symbol PHF19
Protein Name PHD finger protein 19
Synonyms MTF2L1|PCL3|TDRD19B
Ortholog resources KEGG ortholog (KEGG orthology K11486) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095158 IRAL037O22 pDNR-LIB BC022374 NM_001009936 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021457 W01A053K17 pENTR-TOPO IRAL037O22 BC022374 NM_001009936  
HGE021459 W01A053K19 pENTR-TOPO IRAL037O22 BC022374 NM_001009936  
HGE021463 W01A053K23 pENTR-TOPO IRAL037O22 BC022374 NM_001009936  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044548 ARe11G04 pKA1U5 NM_015651.1  
GACTCGGCCGGGCAGCCGCGGGCCGAGCGCAGCCGCCTCCGCCACCGATGCGCCTGGTGG
HKR054012 ARe35A12 pKA1U5 NM_015651.1  
GCTTTTCGAAATCTCCCTGAACTTTGGCGGCCCGAACGCCTCTGGGGGTGTCAGGGGAAG
HKR320409 RBb01A09 pKA1U5 NM_015651.1  
HKR370926 RBd27F06 pGCAP10 NM_015651.1  
GGAAAAAGATGGCGCCCCGCGCCCGGGGGGCCCCTTCCTGAGCGCCCCGGCCCCTCCCTC
HKR389332 RBd73F12 pGCAP10 NM_015651.1  
GACTCGGCCGGGCAGCCGCGGGCCGAGCGCAGCCGCCTCCGCCACCGATGCGCCTGGTGG
HKR471069 RBdS177L05 pGCAP10 NM_015651.1  
GGGGCCGAGCGCAGCCGCCTCCGCCACCGATGCGCCTGGTGGCCAGACTCCAAGTGGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl