Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04792

HP ID(1) HP04792
Gene ID(2) 7318
Gene Symbol finder UBA7
Protein Name ubiquitin-like modifier activating enzyme 7
RefSeq NM_003335.2
Length of RefSeq (bp) 3330
Chromosome 3p21
Reference DDBJ accession
UniGene Hs.16695

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11F04 pKA1U5 GATTCGCTTGGCCTTGGTTCCTGTTTGCACTGGCTACAGCAGGGCACTGGCCCCTACTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl