Prev. |  KEGG KO K10698 > 

RIKEN DNA Bank Human Resource - UBA7

Gene ID NCBI Gene 7318 |  KEGG hsa:7318
Gene Symbol UBA7
Protein Name ubiquitin like modifier activating enzyme 7
Synonyms D8|UBA1B|UBE1L|UBE2
Ortholog resources KEGG ortholog (KEGG orthology K10698) in the DNA Bank
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087096 IRAL017M08 pOTB7 BC006378 NM_003335 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081235 M01C003B11 pDONR221 04-134-2_2-C06 BC006378 NM_003335  
HGE081283 M01C003D11 pDONR221 04-134-2_2-C06 BC006378 NM_003335  
HGE081331 M01C003F11 pDONR221 04-134-2_2-C06 BC006378 NM_003335  
HGE081379 M01C003H11 pDONR221 04-134-2_2-C06 BC006378 NM_003335  
HGE081427 M01C003J11 pDONR221 04-134-2_2-C06 BC006378 NM_003335  
HGE081475 M01C003L11 pDONR221 04-134-2_2-C06 BC006378 NM_003335  
HGE081523 M01C003N11 pDONR221 04-134-2_2-C06 BC006378 NM_003335  
HGE081571 M01C003P11 pDONR221 04-134-2_2-C06 BC006378 NM_003335  
HGE098805 M01C047A05 pDONR221 MGC13-A03 BC006378 NM_003335  
HGE098853 M01C047C05 pDONR221 MGC13-A03 BC006378 NM_003335  
HGE098901 M01C047E05 pDONR221 MGC13-A03 BC006378 NM_003335  
HGE098949 M01C047G05 pDONR221 MGC13-A03 BC006378 NM_003335  
HGE098997 M01C047I05 pDONR221 MGC13-A03 BC006378 NM_003335  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044524 ARe11F04 pKA1U5 NM_003335.2  
GATTCGCTTGGCCTTGGTTCCTGTTTGCACTGGCTACAGCAGGGCACTGGCCCCTACTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl