Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04790

HP ID(1) HP04790
Gene ID(2) 80227
Gene Symbol finder PAAF1
Protein Name proteasomal ATPase-associated factor 1
RefSeq NM_025155.1
Length of RefSeq (bp) 1585
Chromosome 11q13.4
Reference DDBJ accession
UniGene Hs.525017

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11F01 pKA1U5 GGTGGGCTGGTGGAGGCGGGGTCGAGATGGCGGCGCCTTTGAGGATTCAGAGCGACTGGG
ARe67D07 pKA1U5 TGGGTGGAGGCGGGGTCGAGATGGCGGCGCCTTTGAGGATTCAGAGCGACTGGGCGCAAG
ARi15B12 pGCAP10 GGCGGAAGAGGTGGGCTGGTGGAGGCGGGGTCGAGATGGCGGCGCCTTTGAGGATTCAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl