Prev. |  KEGG KO K11887 > 

RIKEN DNA Bank Human Resource - PAAF1

Gene ID NCBI Gene 80227 |  KEGG hsa:80227
Gene Symbol PAAF1
Protein Name proteasomal ATPase associated factor 1
Synonyms PAAF|Rpn14|WDR71
Ortholog resource in our bank

  PAAF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036273 IRAK090L09 pBluescript BC045774 NM_025155 Partial/var
HGY087477 IRAL018L13 pOTB7 BC021541 NM_025155 Full/var
HGY087481 IRAL018L17 pOTB7 BC006142 NM_025155 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044521 ARe11F01 pKA1U5 NM_025155.1  
GGTGGGCTGGTGGAGGCGGGGTCGAGATGGCGGCGCCTTTGAGGATTCAGAGCGACTGGG
HKR066879 ARe67D07 pKA1U5 NM_025155.1  
TGGGTGGAGGCGGGGTCGAGATGGCGGCGCCTTTGAGGATTCAGAGCGACTGGGCGCAAG
HKR166036 ARi15B12 pGCAP10 NM_025155.1  
GGCGGAAGAGGTGGGCTGGTGGAGGCGGGGTCGAGATGGCGGCGCCTTTGAGGATTCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl