Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04756

HP ID(1) HP04756
Gene ID(2) 26064
Gene Symbol finder RAI14
Protein Name retinoic acid induced 14
RefSeq NM_015577.2
Length of RefSeq (bp) 5010
Chromosome 5p13.3-p13.2
Reference DDBJ accession
UniGene Hs.431400

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08H10 pKA1U5 AGGAAGCCGAGCAGGAAGCGAGCCCGGCGGCCGCGTTTTTCCTGGGGAAGCGGCGGGCGG
ARe13B02 pKA1U5 AGGAAGCCGAGCAGGAAGCGAGCCCGGCGGCCGCGTTTTCCTGGGGAAGCGGCGGGCGGG
ARe26H06 pKA1U5 TGGGCGGCCGCGTTTTCCTGGGGAAGCGGCGGGCGGGGTGGAGCAGCCAGCTGGGTCCGG
ARe71C06 pKA1U5 AGGTCGGCGGGGGCCGGCGCCCGGCGGCCACGCNGNTTGNATGCTGCCGCTGCCCCCGCC
ARe73B03 pKA1U5 AATGGGGGACTGCGGCGCAGGAAGCCGAGCAGGNNTTTGAGCCCGGCGGCCGCGTTTTCC
ARi08B08 pGCAP10 GGGCGCCCGGGCGGAGCGGCTGAGCGGGCTGCAGCCGGGGTCCCGCCACCTCTCCCTGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl