Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04750

HP ID(1) HP04750
Gene ID(2) 114971
Gene Symbol finder PTPMT1
Protein Name protein tyrosine phosphatase, mitochondrial 1
RefSeq NM_175732.2
Length of RefSeq (bp) 2651
Chromosome 11p11.2
Reference DDBJ accession
UniGene Hs.700746

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08D04 pKA1U5 GGCTGCGCCGGGCCGTGATGACNGCNACCNNACTGCTTGGACGCCGGCCATGGCNCNGCT
ARe16F04 pKA1U5 GGACGGGTCGCCGCTGCGCCGGGCCGGGATGGCGGCCACCGCGCTGCTGGAGGCCGGCCT
RBd19B06 pGCAP10 CGGCCGGCCGATGGGGCCGACGGGTCGCCGCTGCGCCGGGCCGGGATGGCGGCCACCGCG
RBd28H10 pGCAP10 TGGGGAAGGTGCCGGGTCGGGCGCACCGGGACTGGTACCACCGCATCGACCCCACCGTGC
RBdS187O22 pGCAP10 GGTCGCCGCTGCGCCGGGCCGGGATGGCGGCCACCGCGCTGCTGGAGGCCGGCCTGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl