Prev. |  KEGG KO K14165 > 

RIKEN DNA Bank Human Resource - PTPMT1

Gene ID NCBI Gene 114971 |  KEGG hsa:114971
Gene Symbol PTPMT1
Protein Name protein tyrosine phosphatase mitochondrial 1
Synonyms DUSP23|MOSP|PLIP|PNAS-129
Ortholog resources KEGG ortholog (KEGG orthology K14165) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103268 IRAL058C20 pOTB7 BC073798 NM_001143984.1
HGY091248 IRAL028B24 pOTB7 BC014048
HGY096133 IRAL040F13 pOTB7 BC020242

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043276 ARe08D04 pKA1U5 NM_175732.2  
GGCTGCGCCGGGCCGTGATGACNGCNACCNNACTGCTTGGACGCCGGCCATGGCNCNGCT
HKR046524 ARe16F04 pKA1U5 NM_175732.2  
GGACGGGTCGCCGCTGCGCCGGGCCGGGATGGCGGCCACCGCGCTGCTGGAGGCCGGCCT
HKR367630 RBd19B06 pGCAP10 NM_175732.2  
CGGCCGGCCGATGGGGCCGACGGGTCGCCGCTGCGCCGGGCCGGGATGGCGGCCACCGCG
HKR371378 RBd28H10 pGCAP10 NM_175732.2  
TGGGGAAGGTGCCGGGTCGGGCGCACCGGGACTGGTACCACCGCATCGACCCCACCGTGC
HKR475158 RBdS187O22 pGCAP10 NM_175732.2  
GGTCGCCGCTGCGCCGGGCCGGGATGGCGGCCACCGCGCTGCTGGAGGCCGGCCTGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl