Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04737

HP ID(1) HP04737
Gene ID(2) 745
Gene Symbol finder C11orf9
Protein Name chromosome 11 open reading frame 9
RefSeq NM_013279.1
Length of RefSeq (bp) 5745
Chromosome 11q12-q13.1
Reference DDBJ accession
UniGene Hs.473109

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07D03 pKA1U5 GAGCCGGAGCCCAGCCGGGACTGTCGCGCGGGCCGCGCCGGCGATGCCGCGCCCCCGGGC
ARiS087F23 pGCAP10 GAGAGAGGGGACCCACCGGGCAGGATGCACTGGCTTCCAGCAGGCCACGACATCAACGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl