Prev. | 

RIKEN DNA Bank Human Resource - MYRF

Gene ID NCBI Gene 745 |  KEGG hsa:745
Gene Symbol MYRF
Protein Name myelin regulatory factor
Synonyms 11orf9|C11orf9|CUGS|MMERV|MRF|Ndt80|pqn-47
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042875 ARe07D03 pKA1U5 NM_013279.1  
GAGCCGGAGCCCAGCCGGGACTGTCGCGCGGGCCGCGCCGGCGATGCCGCGCCCCCGGGC
HKR234943 ARiS087F23 pGCAP10 NM_013279.1  
GAGAGAGGGGACCCACCGGGCAGGATGCACTGGCTTCCAGCAGGCCACGACATCAACGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl