Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04736

HP ID(1) HP04736
Gene ID(2) 800
Gene Symbol finder CALD1
Protein Name caldesmon 1
RefSeq NM_033138.2
Length of RefSeq (bp) 5233
Chromosome 7q33
Reference DDBJ accession
UniGene Hs.490203

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07B02 pKA1U5 GAGAGCAGTGTGTATTCGGCTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCT
ARe84E04 pKA1U5 GGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCTTCCTTTCCG
ARe99E04 pKA1U5 ATCCTGGGACTTTCGTCACAGGGACAGACCAACGTGTTAACACAAAGGGAGAACACGGGA
ARi12F09 pGCAP10 GGTTGGAGTGTGTATTCGGCTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCT
ARi43A08 pGCAP10 GTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCT
ARi50G12 pGCAP10 GAGTGTGTATTCGGCTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTA
ARi68H02 pGCAP10 GAGTCCTTCCTTTCCGACTTAGTCCTCGGGAAGAAGTTTCAGACTACAAGGTATCATTGG
ARiS008G22 pGCAP10 GGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCTT
ARiS096H12 pGCAP10 GAGTGTGTATTCGGCTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTA
ARiS109E01 pGCAP10 GAGTCCTTCCTTTCCGACTTAGTCCTCGGGAAGAAGTTTCAGACTACAAGGTATCATTGG
ARiS109P23 pGCAP10 GGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCTT
ARiS150N15 pGCAP10 GGACTTNNTCCTCGGNAANAAGTTTCAGACTACAAGGTATCATTGGAACATTTCAAGATC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl