Prev. |  KEGG KO K12327 > 

RIKEN DNA Bank Human Resource - CALD1

Gene ID NCBI Gene 800 |  KEGG hsa:800
Gene Symbol CALD1
Protein Name caldesmon 1
Synonyms CDM|H-CAD|HCAD|L-CAD|LCAD|NAG22
Ortholog resources KEGG ortholog (KEGG orthology K12327) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011581 IRAK028P21 pCMV-SPORT6 BC040354 NM_004342 Full
HGX055617 IRAK139A17 pCMV-SPORT6 BC061926 NM_033157 Partial/var
HGY091561 IRAL028P01 pOTB7 BC014035 NM_033140 Partial/var
HGY095257 IRAL038C09 pDNR-LIB BC015839 NM_033157 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE080819 M01C002A19 pDONR221 04-134-2_1-E10 BC040354 NM_004342  
HGE080867 M01C002C19 pDONR221 04-134-2_1-E10 BC040354 NM_004342  
HGE080915 M01C002E19 pDONR221 04-134-2_1-E10 BC040354 NM_004342  
HGE080963 M01C002G19 pDONR221 04-134-2_1-E10 BC040354 NM_004342  
HGE081011 M01C002I19 pDONR221 04-134-2_1-E10 BC040354 NM_004342  
HGE081059 M01C002K19 pDONR221 04-134-2_1-E10 BC040354 NM_004342  
HGE081107 M01C002M19 pDONR221 04-134-2_1-E10 BC040354 NM_004342  
HGE081155 M01C002O19 pDONR221 04-134-2_1-E10 BC040354 NM_004342  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042826 ARe07B02 pKA1U5 NM_033138.2  
GAGAGCAGTGTGTATTCGGCTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCT
HKR073700 ARe84E04 pKA1U5 NM_033138.2  
GGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCTTCCTTTCCG
HKR079700 ARe99E04 pKA1U5 NM_033138.2  
ATCCTGGGACTTTCGTCACAGGGACAGACCAACGTGTTAACACAAAGGGAGAACACGGGA
HKR164929 ARi12F09 pGCAP10 NM_033138.2  
GGTTGGAGTGTGTATTCGGCTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCT
HKR177208 ARi43A08 pGCAP10 NM_033138.2  
GTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCT
HKR180156 ARi50G12 pGCAP10 NM_033138.2  
GAGTGTGTATTCGGCTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTA
HKR187370 ARi68H02 pGCAP10 NM_033138.2  
GAGTCCTTCCTTTCCGACTTAGTCCTCGGGAAGAAGTTTCAGACTACAAGGTATCATTGG
HKR203366 ARiS008G22 pGCAP10 NM_033138.2  
GGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCTT
HKR238580 ARiS096H12 pGCAP10 NM_033138.2  
GAGTGTGTATTCGGCTGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTA
HKR243697 ARiS109E01 pGCAP10 NM_033138.2  
GAGTCCTTCCTTTCCGACTTAGTCCTCGGGAAGAAGTTTCAGACTACAAGGTATCATTGG
HKR243983 ARiS109P23 pGCAP10 NM_033138.2  
GGCCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCTT
HKR260327 ARiS150N15 pGCAP10 NM_033138.2  
GGACTTNNTCCTCGGNAANAAGTTTCAGACTACAAGGTATCATTGGAACATTTCAAGATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl