Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04728

HP ID(1) HP04728
Gene ID(2) 23636
Gene Symbol finder NUP62
Protein Name nucleoporin 62kDa
RefSeq NM_153719.2
Length of RefSeq (bp) 3432
Chromosome 19q13.33
Reference DDBJ accession
UniGene Hs.574492

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06F10 pKA1U5 ATCCTGGATTCCCCGCTCGCGACTCCCCACCCCCCAGGGCTCCCTAAAGAGGGCCACGAG
RBd94D01 pGCAP10 GAAAGAGGGCCACGAGCTGCGAAAGGGCGGGAAAGGCAGTTGGAGAAGAGGTAAGCGGTT
RBdS110N17 pGCAP10 GACTCCCCACCCCCCAGGGCTCCCTAAAGAGGGCCACGAGCTGCGAAAGGGCGGGAAAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl