Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUP62

Gene ID (NCBI) 23636
Gene Symbol NUP62
Protein Name nucleoporin 62
Synonyms IBSN|SNDI|p62
Databases KEGG hsa:23636 |  NCBI Gene 23636
Featured content Ortholog resources in the DNA Bank (KEGG orthology K14306)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX011311 IRAK028E15 pCMV-SPORT6 BC014842 NM_153719 Full
HGX044173 IRAK110H05 pCMV-SPORT6 BC050717 NM_153719 Full
HGY081246 IRAL003B22 pOTB7 BC003663 NM_153719 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022642 W01A056K02 pENTR-TOPO IRAK028E15 BC014842 NM_153719  
HGE015659 W01A039C11 pENTR-TOPO IRAL003B22 BC003663 NM_153719  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042530 ARe06F10 pKA1U5 NM_153719.2  
ATCCTGGATTCCCCGCTCGCGACTCCCCACCCCCCAGGGCTCCCTAAAGAGGGCCACGAG
HKR397673 RBd94D01 pGCAP10 NM_153719.2  
GAAAGAGGGCCACGAGCTGCGAAAGGGCGGGAAAGGCAGTTGGAGAAGAGGTAAGCGGTT
HKR444329 RBdS110N17 pGCAP10 NM_153719.2  
GACTCCCCACCCCCCAGGGCTCCCTAAAGAGGGCCACGAGCTGCGAAAGGGCGGGAAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl