Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04721

HP ID(1) HP04721
Gene ID(2) 6917
Gene Symbol finder TCEA1
Protein Name transcription elongation factor A (SII), 1
RefSeq NM_006756.2
Length of RefSeq (bp) 2784
Chromosome 8q11.2
Reference DDBJ accession
UniGene Hs.491745

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05F11 pKA1U5 AGGAAGGGGGCCTAGGCCCGGGCCTGCGGTGGTGGGGGTTGCTGCGCCCCTN
ARe43G03 pKA1U5 AGGAAGGGGGCCTAGGCCCGGGCCTGCGGTGGTGGGGGTTGCTGCGCGCCGGGGGCCNTT
ARiS122C02 pGCAP10 GGCCGCCGCGGGCTTCGTTCGTAAGGAAGGGGGCCTAGGCCCGGGCCTGCGGTGGTGGGG
RBb19E05 pKA1U5 GGCCTAGGCCCGGGCCTGCGGTGGTGGGGGTTGCTGCGCGCCGGGGGTCGCTCCTGCTGT
RBb24B10 pGCAP1 GGTTGGCGCGCACGCGCCTGAGCGTGCGCCCGGTGGGGCCGGCCGGGACTCGCCGCTCGC
RBd29C10 pGCAP10 GGCCGCCGCCGCCGCCGCCGCCGCGGGCTTCGTTCGTAAGGAAGGGGGCCTAGGCCCGGG
RBdS070I20 pGCAP10 GGAGCCGGAGCCGCCGCCGCCGCCGCCGCCGCCGCGGGCTTCGTTCGTAAGGAAGGGGGC
RBdS075C03 pGCAP10 TGGCCGCGGGCTTCGTTCGTAAGGAAGGGGGCCTAGGCCCGGGCCTGCGGTGGTGGGGGT
RBdS081J09 pGCAP10 GAATTTAGCTTAGGAATTGAAGCGTAGAAAGTCCTCAGAACTTGAAAGAATGGAGTCTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl