Prev. |  KEGG KO K03145 > 

RIKEN DNA Bank Human Resource - TCEA1

Gene ID NCBI Gene 6917 |  KEGG hsa:6917
Gene Symbol TCEA1
Protein Name transcription elongation factor A1
Synonyms GTF2S|SII|TCEA|TF2S|TFIIS
Ortholog resource in our bank

  TCEA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069950 IRAK174O14 pCMV-SPORT6 BC072460 NM_006756 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE011122 W01A027N10 pENTR-TOPO IRAK174O14 BC072460 NM_006756  
HGE011124 W01A027N12 pENTR-TOPO IRAK174O14 BC072460 NM_006756  
HGE011126 W01A027N14 pENTR-TOPO IRAK174O14 BC072460 NM_006756  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042131 ARe05F11 pKA1U5 NM_006756.2  
AGGAAGGGGGCCTAGGCCCGGGCCTGCGGTGGTGGGGGTTGCTGCGCCCCTN
HKR057347 ARe43G03 pKA1U5 NM_006756.2  
AGGAAGGGGGCCTAGGCCCGGGCCTGCGGTGGTGGGGGTTGCTGCGCGCCGGGGGCCNTT
HKR248850 ARiS122C02 pGCAP10 NM_006756.2  
GGCCGCCGCGGGCTTCGTTCGTAAGGAAGGGGGCCTAGGCCCGGGCCTGCGGTGGTGGGG
HKR327701 RBb19E05 pKA1U5 NM_006756.2  
GGCCTAGGCCCGGGCCTGCGGTGGTGGGGGTTGCTGCGCGCCGGGGGTCGCTCCTGCTGT
HKR329634 RBb24B10 pGCAP1 NM_006756.2  
GGTTGGCGCGCACGCGCCTGAGCGTGCGCCCGGTGGGGCCGGCCGGGACTCGCCGCTCGC
HKR371658 RBd29C10 pGCAP10 NM_006756.2  
GGCCGCCGCCGCCGCCGCCGCCGCGGGCTTCGTTCGTAAGGAAGGGGGCCTAGGCCCGGG
HKR428212 RBdS070I20 pGCAP10 NM_006756.2  
GGAGCCGGAGCCGCCGCCGCCGCCGCCGCCGCCGCGGGCTTCGTTCGTAAGGAAGGGGGC
HKR430051 RBdS075C03 pGCAP10 NM_006756.2  
TGGCCGCGGGCTTCGTTCGTAAGGAAGGGGGCCTAGGCCCGGGCCTGCGGTGGTGGGGGT
HKR432625 RBdS081J09 pGCAP10 NM_006756.2  
GAATTTAGCTTAGGAATTGAAGCGTAGAAAGTCCTCAGAACTTGAAAGAATGGAGTCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl