Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04712

HP ID(1) HP04712
Gene ID(2) 133619
Gene Symbol finder PRRC1
Protein Name proline-rich coiled-coil 1
RefSeq NM_130809.3
Length of RefSeq (bp) 4700
Chromosome 5q23.2
Reference DDBJ accession
UniGene Hs.483259

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04H12 pKA1U5 GAGGCGGGGCACACGCCGAGGTAACTTCCAGGGTGCGCCTTCGNTTGTCTTCTCCAAGCT
ARe46H10 pKA1U5 GAGGGTGCGCCTTCGNTTGTCTTCTCCAAGCTGCCCNTTNNACGATCCCGACCTCCCTAT
ARi47C04 pGCAP10 GCAGGGTGCGCCTTCGTTGTCTTCTCCAAGCTGTAGTTCTACGTCCCGACCTCCCTATCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl