Prev. | 

RIKEN DNA Bank Human Resource - PRRC1

Gene ID NCBI Gene 133619 |  KEGG hsa:133619
Gene Symbol PRRC1
Protein Name proline rich coiled-coil 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009057 IRAK022K17 pCMV-SPORT6 BC017066 NM_130809 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041780 ARe04H12 pKA1U5 NM_130809.3  
GAGGCGGGGCACACGCCGAGGTAACTTCCAGGGTGCGCCTTCGNTTGTCTTCTCCAAGCT
HKR058578 ARe46H10 pKA1U5 NM_130809.3  
GAGGGTGCGCCTTCGNTTGTCTTCTCCAAGCTGCCCNTTNNACGATCCCGACCTCCCTAT
HKR178852 ARi47C04 pGCAP10 NM_130809.3  
GCAGGGTGCGCCTTCGTTGTCTTCTCCAAGCTGTAGTTCTACGTCCCGACCTCCCTATCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl