Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04701

HP ID(1) HP04701
Gene ID(2) 81839
Gene Symbol finder VANGL1
Protein Name vang-like 1 (van gogh, Drosophila)
RefSeq NM_138959.2
Length of RefSeq (bp) 8691
Chromosome 1p11-p13.1
Reference DDBJ accession
UniGene Hs.515130

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04C01 pKA1U5 GGCAGTGCAGCGGCGGCGGCGGCGGGGCTCTGCCTCTCCAGGAGCCCAGCGCAGGCCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl