Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04693

HP ID(1) HP04693
Gene ID(2) 56683
Gene Symbol finder C21orf59
Protein Name chromosome 21 open reading frame 59
RefSeq NM_021254.1
Length of RefSeq (bp) 1064
Chromosome 21q22.1
Reference DDBJ accession
UniGene Hs.5811

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03D02 pKA1U5 GGTTAGTGCGTCGCAGCTGCTGGCGATCCGGCGACCCTCGGCCGGCAGGACCCGCGGGCC
ARiS198G04 pGCAP10 GGNGNGCCGNNCCCCCGCTCACCGCGGGCTAGGGAGCGNGGGATTCCGGACNGTGAGCGG
RBd29D05 pGCAP10 GGGGATTCCGGACTGTGAGCGGCTGTTAGTGCGTCGCAGCTGCTGGCGATCCGGCGACCC
RBd37E06 pGCAP10 GGCAGCTGCTGGCGATCCGGCGACCCTCGGCCGGCAGGACCCGCGGGCCACGCAGCCGGG
RBd48E07 pGCAP10 GAGAATCAGCTGTCCTCTCAGACTGTGTGGGTGGTTTCCCCGGCCGCAGCTCCGTACGGG
RBd54F06 pGCAP10 GAGAATCAGCTGTCCTCTCAGACTGTGTGGGTGGTTTCCCCGGCCGCAGCTCCGTACGGG
RBd72B07 pGCAP10 CGGCCGGCCGATGAGAATCAGCTGTCCTCTCAGACTGTGTGGGTGGTTTCCCCGGCCGCA
RBd92A02 pGCAP10 GGTCCTCTCAGACTGTGTGGGTGGTTTCCCCGGCCGCAGCTCCGTACGGGCTTGGATTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl