Prev. | 

RIKEN DNA Bank Human Resource - CFAP298

Gene ID NCBI Gene 56683 |  KEGG hsa:56683
Gene Symbol CFAP298
Protein Name cilia and flagella associated protein 298
Synonyms C21orf48|C21orf59|CILD26|FBB18|Kur
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083091 IRAL007M03 pOTB7 BC000709 NM_021254 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041274 ARe03D02 pKA1U5 NM_021254.1  
GGTTAGTGCGTCGCAGCTGCTGGCGATCCGGCGACCCTCGGCCGGCAGGACCCGCGGGCC
HKR279348 ARiS198G04 pGCAP10 NM_021254.1  
GGNGNGCCGNNCCCCCGCTCACCGCGGGCTAGGGAGCGNGGGATTCCGGACNGTGAGCGG
HKR371677 RBd29D05 pGCAP10 NM_021254.1  
GGGGATTCCGGACTGTGAGCGGCTGTTAGTGCGTCGCAGCTGCTGGCGATCCGGCGACCC
HKR374902 RBd37E06 pGCAP10 NM_021254.1  
GGCAGCTGCTGGCGATCCGGCGACCCTCGGCCGGCAGGACCCGCGGGCCACGCAGCCGGG
HKR379303 RBd48E07 pGCAP10 NM_021254.1  
GAGAATCAGCTGTCCTCTCAGACTGTGTGGGTGGTTTCCCCGGCCGCAGCTCCGTACGGG
HKR381726 RBd54F06 pGCAP10 NM_021254.1  
GAGAATCAGCTGTCCTCTCAGACTGTGTGGGTGGTTTCCCCGGCCGCAGCTCCGTACGGG
HKR388831 RBd72B07 pGCAP10 NM_021254.1  
CGGCCGGCCGATGAGAATCAGCTGTCCTCTCAGACTGTGTGGGTGGTTTCCCCGGCCGCA
HKR396802 RBd92A02 pGCAP10 NM_021254.1  
GGTCCTCTCAGACTGTGTGGGTGGTTTCCCCGGCCGCAGCTCCGTACGGGCTTGGATTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl