Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04692

HP ID(1) HP04692
Gene ID(2) 126792
Gene Symbol finder B3GALT6
Protein Name UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
RefSeq NM_080605.3
Length of RefSeq (bp) 2793
Chromosome 1p36.33
Reference DDBJ accession
UniGene Hs.284284

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03C03 pKA1U5 GGCCGGCCCGGCGCGGGCGCCATGAAGCTGCTGCGGTGGGCGNTGGCGGCGGCGGGCGGC
RBd01G04 pGCAP10 GAGCTGCTGCCCGTGGGCGTGGCGGCGGCGGGCGGCGCTAGGCCTGGGCACGCTGGCGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl