Prev. |  KEGG KO K00734 > 

RIKEN DNA Bank Human Resource - B3GALT6

Gene ID NCBI Gene 126792 |  KEGG hsa:126792
Gene Symbol B3GALT6
Protein Name beta-1,3-galactosyltransferase 6
Synonyms EDSP2|EDSSPD2|SEMDJL1|beta3GalT6
Ortholog resource in our bank

  B3GALT6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097635 IRAL044B11 pOTB7 BC041621 NM_080605 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041251 ARe03C03 pKA1U5 NM_080605.3  
GGCCGGCCCGGCGCGGGCGCCATGAAGCTGCTGCGGTGGGCGNTGGCGGCGGCGGGCGGC
HKR360548 RBd01G04 pGCAP10 NM_080605.3  
GAGCTGCTGCCCGTGGGCGTGGCGGCGGCGGGCGGCGCTAGGCCTGGGCACGCTGGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl