Prev. |  KEGG KO K00734 > 

RIKEN DNA Bank Human Resource - B3GALT6

Gene ID NCBI Gene 126792 |  KEGG hsa:126792
Gene Symbol B3GALT6
Protein Name beta-1,3-galactosyltransferase 6
Synonyms EDSP2|EDSSPD2|SEMDJL1|beta3GalT6
Ortholog resources KEGG ortholog (KEGG orthology K00734) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097635 IRAL044B11 pOTB7 BC041621 NM_080605 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041251 ARe03C03 pKA1U5 NM_080605.3  
GGCCGGCCCGGCGCGGGCGCCATGAAGCTGCTGCGGTGGGCGNTGGCGGCGGCGGGCGGC
HKR360548 RBd01G04 pGCAP10 NM_080605.3  
GAGCTGCTGCCCGTGGGCGTGGCGGCGGCGGGCGGCGCTAGGCCTGGGCACGCTGGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl