Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04682

HP ID(1) HP04682
Gene ID(2) 1827
Gene Symbol finder RCAN1
Protein Name regulator of calcineurin 1
RefSeq NM_203418.1
Length of RefSeq (bp) 2434
Chromosome 21q22.1-q22.2; 21q22.12
Reference DDBJ accession
UniGene Hs.282326

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02B07 pKA1U5 GAGCCTCTTGGAAAGGAATCTCACTAGGGGCTTGACTGCGTGGGTCTGTAGCGCTTTCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl