Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04677

HP ID(1) HP04677
Gene ID(2) 79001
Gene Symbol finder VKORC1
Protein Name vitamin K epoxide reductase complex, subunit 1
RefSeq NM_024006.4
Length of RefSeq (bp) 1042
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.324844

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02A04 pKA1U5 GGCGGGCGCCTCGGGCGGAACCTGGAGATAATGNGCAGCACCTGGGGGAGCCCTGGCTGG
ARe16G10 pKA1U5 GGAGATAATGGGCAGCACCTGGGGGAGCCCTGGCTGGGTGCGGCTCGCTCTTTGCCTGAC
ARf07F02 pKA1U5 GATTCTTCGCTGTTTTCCTAACTCGCCCGCTTGACTAGCGCCCTGGAACAGCCATTTGGG
ARi23A08 pGCAP10 GGCTGGTTTTCTCCGCGGGCGCCTCGGGCGGAACCTGGAGATAATGGGCAGCACCTGGGG
ARiS023C22 pGCAP10 CGGCCGGCCGATGGCCTCGGGCGGAACCTGGAGATAATGGGCAGCACCTGGGGGAGCCCT
ARiS109P20 pGCAP10 CGGCCGGCCGATGGCCTCGGGCGGAACCTGGAGATAATGGGCAGCACCTGGGGGANCCCT
ARiS122J23 pGCAP10 CGGCCGGCCGATGGAGATAATGGGCAGCACCTGGGGGAGCCCTGGCTGGGTGCGGCTCGC
ARiS150C16 pGCAP10 GGCCCGGCCCCTGCTCCGTGGCTGGTTTTCTCCGCGGGCGCCTCGGGCGGAACCTGGAGA
RBb11F11 pKA1U5 GCATTCGCCGCCCGGCCCCTGCTCCGTGGCTGNCCTTTTAANGCGGGCGCCTCGGGCGGA
RBd19H09 pGCAP10 GGCCTCGGGCGGAACCTGGAGATAATGGGCAGCACCTGGGGGAGCCCTGGCTGGGTGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl