Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04672

HP ID(1) HP04672
Gene ID(2) 56889
Gene Symbol finder TM9SF3
Protein Name transmembrane 9 superfamily member 3
RefSeq NM_020123.3
Length of RefSeq (bp) 6140
Chromosome 10q24.1
Reference DDBJ accession
UniGene Hs.500674

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01E12 pKA1U5 GGAGGCTCACGAGCGGGCGGTGACTGCGACGCCGGCGGCATAGGAGGCCGCGGCTGGGCC
ARi14C08 pGCAP10 GGAGGCGCGGGGGGCGGGGGAGGCTCAGGAGCGGGCGGTGACGGCGACGGCGGCGGCAGA
ARiS118A03 pGCAP10 GAGGAGCGGGCGGTGACGGCGACGGCGGCGGCAGAGGAGGCAGCGGCTGGGCCGGGCCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl