Prev. |  KEGG KO K17087 > 

RIKEN DNA Bank Human Resource - TM9SF3

Gene ID NCBI Gene 56889 |  KEGG hsa:56889
Gene Symbol TM9SF3
Protein Name transmembrane 9 superfamily member 3
Synonyms EP70-P-iso|SMBP
Ortholog resource in our bank

  TM9SF3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008277 IRAK020L13 pCMV-SPORT6 BC020959 NM_020123 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040508 ARe01E12 pKA1U5 NM_020123.3  
GGAGGCTCACGAGCGGGCGGTGACTGCGACGCCGGCGGCATAGGAGGCCGCGGCTGGGCC
HKR165656 ARi14C08 pGCAP10 NM_020123.3  
GGAGGCGCGGGGGGCGGGGGAGGCTCAGGAGCGGGCGGTGACGGCGACGGCGGCGGCAGA
HKR247203 ARiS118A03 pGCAP10 NM_020123.3  
GAGGAGCGGGCGGTGACGGCGACGGCGGCGGCAGAGGAGGCAGCGGCTGGGCCGGGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl