Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04666

HP ID(1) HP04666
Gene ID(2) 94107
Gene Symbol finder TMEM203
Protein Name transmembrane protein 203
RefSeq NM_053045.1
Length of RefSeq (bp) 1576
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.591886

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01A02 pKA1U5 GGCCCTGTGGGGGCATGGCGTCCGATCGAGGCGGGCGTTCACGGGCGGCCAGGGTTGAGT
ARiS122E14 pGCAP10 GCCTGTGGGGGCATGGCGTCCGATCGAGGCGGGCGTTCACGGGCGGCCAGGGTTGAGTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl