Prev. | 

RIKEN DNA Bank Human Resource - TMEM203

Gene ID NCBI Gene 94107 |  KEGG hsa:94107
Gene Symbol TMEM203
Protein Name transmembrane protein 203
Synonyms HBEBP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067178 IRAK167P18 pBluescriptR BC067786 NM_053045 Full/var
HGY088217 IRAL020J01 pOTB7 BC009283 NM_053045 Full
HGY089488 IRAL023L24 pOTB7 BC009461 NM_053045

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040402 ARe01A02 pKA1U5 NM_053045.1  
GGCCCTGTGGGGGCATGGCGTCCGATCGAGGCGGGCGTTCACGGGCGGCCAGGGTTGAGT
HKR248910 ARiS122E14 pGCAP10 NM_053045.1  
GCCTGTGGGGGCATGGCGTCCGATCGAGGCGGGCGTTCACGGGCGGCCAGGGTTGAGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl