Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04665

HP ID(1) HP04665
Gene ID(2) 79033
Gene Symbol finder PRNPIP
Protein Name prion protein interacting protein
RefSeq NM_024066.1
Length of RefSeq (bp) 1769
Chromosome 1p32
Reference DDBJ accession
UniGene Hs.132497

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi53H10 pGCAP10 GGGGGTCAGAGTGCGCGGAGCATTGGGGCTTTCCAGCTCTCACAGAACCTTCAGCATCCC
RBd58H01 pGCAP10 GGTGCGCGGAGCATTGGGGCTTTCCAGCTCTCACAGAACCTTCAGCATCCCCAGCTGCCG
RBdS081O19 pGCAP10 GGGGGTCAGAGTGCGCGGAGCATTGGGGCTTTCCAGCTCTCACAGAACCTTCAGCATCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl