Prev. |  KEGG KO K18418 > 

RIKEN DNA Bank Human Resource - ERI3

Gene ID NCBI Gene 79033 |  KEGG hsa:79033
Gene Symbol ERI3
Protein Name ERI1 exoribonuclease family member 3
Synonyms PINT1|PRNPIP
Ortholog resource in our bank

  ERI3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080901 IRAL002E05 pOTB7 BC001072 NM_024066 Partial
HGY083609 IRAL009A09 pOTB7 BC004456 NM_024066 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181378 ARi53H10 pGCAP10 NM_024066.1  
GGGGGTCAGAGTGCGCGGAGCATTGGGGCTTTCCAGCTCTCACAGAACCTTCAGCATCCC
HKR383369 RBd58H01 pGCAP10 NM_024066.1  
GGTGCGCGGAGCATTGGGGCTTTCCAGCTCTCACAGAACCTTCAGCATCCCCAGCTGCCG
HKR432755 RBdS081O19 pGCAP10 NM_024066.1  
GGGGGTCAGAGTGCGCGGAGCATTGGGGCTTTCCAGCTCTCACAGAACCTTCAGCATCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl