Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04659

HP ID(1) HP04659
Gene ID(2) 8031
Gene Symbol finder NCOA4
Protein Name nuclear receptor coactivator 4
RefSeq NM_005437.3
Length of RefSeq (bp) 3502
Chromosome 10q11.2
Reference DDBJ accession
UniGene Hs.643658

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi22G10 pGCAP10 GGGGCCGTAGGTTAGTGTGGGGCCGTGTCTCAGTCCACCCAAGGTCTCCTCGGATCGCCT
ARi38C11 pGCAP10 GGTGGGGCCGTGTCTCAGTCCACCCAAGGTCTCCTCGGATCGCCTGGAGAGGCACTCGGA
RBdS104D22 pGCAP10 GAACTCTGCCTTTGGGCCGTAGGTTAGTGTGGGGCCGTGTCTCAGTCCACCCAAGGTCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl