Prev. |  KEGG KO K09289 > 

RIKEN DNA Bank Human Resource - NCOA4

Gene ID NCBI Gene 8031 |  KEGG hsa:8031
Gene Symbol NCOA4
Protein Name nuclear receptor coactivator 4
Synonyms ARA70|ELE1|PTC3|RFG
Ortholog resource in our bank

  NCOA4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19189 NCOA4-mCherry Expression vector of human NCOA4 tagged with mCherry at C-terminus.
RDB19190 NCOA4(I489A/W497A)-mCherry Expression vector of human NCOA4 mutant (I489A/W497A) tagged with mCherry at C-terminus.
RDB19193 pGEX2T-NCOA4(382-522) Expression vector of human NCOA4 residue (382-522) tagged with GST at N-terminus.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001817 IRAK004J01 pCMV-SPORT6 BC001562 NM_005437 Full
HGY090007 IRAL025A07 pOTB7 BC012736 NM_005437 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002817 W01A007A17 pENTR-TOPO IRAK004J01 BC001562 NM_005437  
HGE002819 W01A007A19 pENTR-TOPO IRAK004J01 BC001562 NM_005437  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168954 ARi22G10 pGCAP10 NM_005437.3  
GGGGCCGTAGGTTAGTGTGGGGCCGTGTCTCAGTCCACCCAAGGTCTCCTCGGATCGCCT
HKR175259 ARi38C11 pGCAP10 NM_005437.3  
GGTGGGGCCGTGTCTCAGTCCACCCAAGGTCTCCTCGGATCGCCTGGAGAGGCACTCGGA
HKR441694 RBdS104D22 pGCAP10 NM_005437.3  
GAACTCTGCCTTTGGGCCGTAGGTTAGTGTGGGGCCGTGTCTCAGTCCACCCAAGGTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.07.20

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl