Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04655

HP ID(1) HP04655
Gene ID(2) 84987
Gene Symbol finder C12orf62
Protein Name chromosome 12 open reading frame 62
RefSeq NM_032901.2
Length of RefSeq (bp) 643
Chromosome 12q13.13
Reference DDBJ accession
UniGene Hs.388645

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe54D04 pKA1U5 GANTGNTCTCCAGACCCTGCCTGCCTGAGGAGGCCTCGNGTATGNATGCCGAACGAGNCT
ARe97B01 pKA1U5 GGGTTCCGAGCTGCTGCGNTTCGGCTGTGCTGGGAAGTTGCGCTAGACAGTTGGCCTCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl