Prev. |  KEGG KO K18181 > 

RIKEN DNA Bank Human Resource - COX14

Gene ID NCBI Gene 84987 |  KEGG hsa:84987
Gene Symbol COX14
Protein Name cytochrome c oxidase assembly factor COX14
Synonyms C12orf62|PCAG1
Ortholog resource in our bank

  COX14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088200 IRAL020I08 pOTB7 BC007849 NM_032901

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061676 ARe54D04 pKA1U5 NM_032901.2  
GANTGNTCTCCAGACCCTGCCTGCCTGAGGAGGCCTCGNGTATGNATGCCGAACGAGNCT
HKR078825 ARe97B01 pKA1U5 NM_032901.2  
GGGTTCCGAGCTGCTGCGNTTCGGCTGTGCTGGGAAGTTGCGCTAGACAGTTGGCCTCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl