Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04654

HP ID(1) HP04654
Gene ID(2) 56271
Gene Symbol finder BEX4
Protein Name BEX family member 4
RefSeq NM_001080425.2
Length of RefSeq (bp) 1290
Chromosome Xq22.1-q22.3
Reference DDBJ accession
UniGene Hs.184736

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66E06 pKA1U5 GGTCGTGGCTCGTTCCATTCTCGGCGGTGGTACCTGCTCCCGGTGGCCCTGAGGACGTGT
ARi50G06 pGCAP10 TGGAGTGTTGTCTCGCTCTGGCGTCAGAGCCGTCGTGGCTCGTTCCATTCTCGGCGGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl