Prev. | 

RIKEN DNA Bank Human Resource - BEX4

Gene ID NCBI Gene 56271 |  KEGG hsa:56271
Gene Symbol BEX4
Protein Name brain expressed X-linked 4
Synonyms BEXL1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006115 IRAK015E19 pCMV-SPORT6 BC015794 XM_936467 Full
HGY101712 IRAL054E16 pOTB7 BC068069 XM_936467 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066502 ARe66E06 pKA1U5 NM_001080425.2  
GGTCGTGGCTCGTTCCATTCTCGGCGGTGGTACCTGCTCCCGGTGGCCCTGAGGACGTGT
HKR180150 ARi50G06 pGCAP10 NM_001080425.2  
TGGAGTGTTGTCTCGCTCTGGCGTCAGAGCCGTCGTGGCTCGTTCCATTCTCGGCGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl