Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04652

HP ID(1) HP04652
Gene ID(2) 51079
Gene Symbol finder NDUFA13
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
RefSeq NM_015965.5
Length of RefSeq (bp) 1081
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.534453

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04H02 pKA1U5 GGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCANGACATGCCTCCGCCGGGGGGCTA
ARe08A01 pKA1U5 GACTGCGAGCTATGGCGGCGTCAAAGGTGAAGCANGACATGCCTCCGCCGGGGGGCTATG
ARe97D10 pKA1U5 GGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
ARi18A09 pGCAP10 GGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
ARi66D09 pGCAP10 GGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
ARiS096C22 pGCAP10 GGGGNTACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
RBb12D09 pKA1U5 GGGGACCGGAAGTGTGGGATACTGCGAGTATGGCGGCGATCAAAGGTGAAGCAGGACATG
RBb17G03 pKA1U5 GATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCTAT
RBb53B04 pGCAP1 GGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGG
RBb54F12 pGCAP1 GGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGG
RBb60E06 pGCAP1 GGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
RBd47C02 pGCAP10 GCTTGGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGG
RBd55D05 pGCAP10 GACCGGAAGTGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAANCAGGACATGCCTC
RBdS083D15 pGCAP10 GGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl