Prev. |  KEGG KO K11353 > 

RIKEN DNA Bank Human Resource - NDUFA13

Gene ID NCBI Gene 51079 |  KEGG hsa:51079
Gene Symbol NDUFA13
Protein Name NADH:ubiquinone oxidoreductase subunit A13
Synonyms B16.6|CDA016|CGI-39|GRIM-19|GRIM19
Ortholog resources KEGG ortholog (KEGG orthology K11353) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082014 IRAL005A14 pOTB7 BC000589 NM_015965 Partial
HGY090262 IRAL025K22 pOTB7 BC009189 NM_015965 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038566 W01A096G22 pENTR-TOPO IRAL005A14 BC000589 NM_015965  
HGE038568 W01A096G24 pENTR-TOPO IRAL005A14 BC000589 NM_015965  
HGE047843 W01A119K03 pENTR-TOPO IRAL005A14 BC000589 NM_015965  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041770 ARe04H02 pKA1U5 NM_015965.5  
GGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCANGACATGCCTCCGCCGGGGGGCTA
HKR043201 ARe08A01 pKA1U5 NM_015965.5  
GACTGCGAGCTATGGCGGCGTCAAAGGTGAAGCANGACATGCCTCCGCCGGGGGGCTATG
HKR078882 ARe97D10 pKA1U5 NM_015965.5  
GGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
HKR167209 ARi18A09 pGCAP10 NM_015965.5  
GGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
HKR186481 ARi66D09 pGCAP10 NM_015965.5  
GGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
HKR238470 ARiS096C22 pGCAP10 NM_015965.5  
GGGGNTACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
HKR324881 RBb12D09 pKA1U5 NM_015965.5  
GGGGACCGGAAGTGTGGGATACTGCGAGTATGGCGGCGATCAAAGGTGAAGCAGGACATG
HKR326947 RBb17G03 pKA1U5 NM_015965.5  
GATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCTAT
HKR341228 RBb53B04 pGCAP1 NM_015965.5  
GGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGG
HKR341732 RBb54F12 pGCAP1 NM_015965.5  
GGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGG
HKR344102 RBb60E06 pGCAP1 NM_015965.5  
GGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGC
HKR378850 RBd47C02 pGCAP10 NM_015965.5  
GCTTGGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGG
HKR382077 RBd55D05 pGCAP10 NM_015965.5  
GACCGGAAGTGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAANCAGGACATGCCTC
HKR433287 RBdS083D15 pGCAP10 NM_015965.5  
GGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl